Home - GyroDb Overview - News and Events - Biology - Biosystematics - Protocols - Submissions - Contacts

 

Tools



   List World Gyros

   Find Hosts for Gyro

   Find Gyros for Hosts



   View Hosts by Gyro

   View Gyros by Host

   View Sclerite Images


   View Hook Overlays


Gyrodactylus molecular markers

Gyrodactylus molecular markers

The Ribosomal DNA cassette

Most molecular markers for Gyrodactylus have been within the ribosomal gene cassette.

Two approaches have been used. Cable et. al. (1999, 2000, 2003) and Matejusova et al. (2001) have amplified ITS-1 and ITS-2 separately using primers within the 5.8S rDNA to give a short length of overlap within the 5.8S gene. Other workers tend to amplify ITS-1, 5.8S rDNA and ITS-2 as a single amplicon. Thus the forward primer for both approaches tends to be the same, but different reverse primers in ITS-2 are used.

Amplifying ITS-1-5.8S-ITS-2 as a single amplicon

ITS-1 forward primer

Two used commonly, designed by Cunningham (1997), used subsequently by Cunningham, Volckaert & Lumme groups, and that designed by Cable et al. (1999), used subsequently by the Cable group. Cable primer begins 7 bases 5' of the Cunningham primer, and extends a further 12 bases 3'. Matejusova et al. (2001) working with Cunningham, redesigned the Cunningham primer to extend even further 5'. These primers lie just within the 3' boundary of the 18S rDNA gene.

Cable primer P3b:

P3b 5' TAGGTGAACCTGCAGAAGGATCA 3'

Cunningham (1997) primer ITS-1-F

Primer 1, forward ITS-1-F: 5'-TTTCCGTAGGTGAACCT-3'

Matejusova et al. (2001) forward primer:

5'-GTAACAAGGTTTCCGTAGGTG-3'

ITS-2 reverse primer

The Matejusova et al (2001) and Cable group primers, used to amplify 5.8S-18S through ITS-2, are similar. The Matejusova primer lies within the Cable primer. note the one base pair difference (T-G) between these primers,6 bp 5' of the priming end. Neither of these primers are ideal, as both have mismatches compared to the G. salaris 28S gene. The Cable primer in particular has an extra A set three bases back from the priming site. This may account for the equivocal performance of this primer on some templates.

Huyse, Zietara, Primer 2, reverse ITS-2-R:

5'-GGTAATCACGCTTGAATC-3'

Cable group reverse ITS-2 primer:

5'-GTCCGGATCCTCCGCTTATTGATATTGC-3'

Matejusova et al., 2001 reverse primer

5-TCCTCCGCTTAGTGATA-3'

The Huyse primer binds to the 28S gene some 20bp 5' of the Cable and Matejusova primers. Again, it is not a perfect match with the G. salaris sequence.

Conditions for amplification:

Huyse, Zietara use the following conditions:

4 minutes at 95C then;

1 min 95C

1 min 50C

2 min 72C

for 35 cycles

Cable et al. (1999) used a more complex protocol with higher annealing temperature:

2 mins at 94C then:

15s at 94C

30s at 60C

45s at 72C

increasing extension times by 15s every 4 cycles until after 30 cycles final conditions were:

15s at 94C

30s at 60C

2 mins at 72C

Reaction terminated with a 6 min extension step at 72C.




Home - GyroDb Overview - News and Events - Biology - Biosystematics - Protocols - Submissions - Contacts

This site is © Copyright GyroDb 2007, All Rights Reserved