Gyrodactylus molecular markers
Gyrodactylus molecular markers
The Ribosomal DNA cassette
Most molecular markers for Gyrodactylus have been within the ribosomal gene cassette.
Two approaches have been used. Cable et. al. (1999, 2000, 2003) and Matejusova et al. (2001) have amplified ITS-1 and ITS-2 separately using primers within the 5.8S rDNA to give a short length of overlap within the 5.8S gene. Other workers tend to amplify ITS-1, 5.8S rDNA and ITS-2 as a single amplicon. Thus the forward primer for both approaches tends to be the same, but different reverse primers in ITS-2 are used.
Amplifying ITS-1-5.8S-ITS-2 as a single amplicon
ITS-1 forward primer
Two used commonly, designed by Cunningham (1997), used subsequently by Cunningham, Volckaert & Lumme groups, and that designed by Cable et al. (1999), used subsequently by the Cable group. Cable primer begins 7 bases 5' of the Cunningham primer, and extends a further 12 bases 3'. Matejusova et al. (2001) working with Cunningham, redesigned the Cunningham primer to extend even further 5'. These primers lie just within the 3' boundary of the 18S rDNA gene.
Cable primer P3b:
P3b 5' TAGGTGAACCTGCAGAAGGATCA 3'
Cunningham (1997) primer ITS-1-F
Primer 1, forward ITS-1-F: 5'-TTTCCGTAGGTGAACCT-3'
Matejusova et al. (2001) forward primer:
5'-GTAACAAGGTTTCCGTAGGTG-3'
ITS-2 reverse primer
The Matejusova et al (2001) and Cable group primers, used to amplify 5.8S-18S through ITS-2, are similar. The Matejusova primer lies within the Cable primer. note the one base pair difference (T-G) between these primers,6 bp 5' of the priming end. Neither of these primers are ideal, as both have
mismatches compared to the G. salaris 28S gene. The Cable primer in particular has an extra A set three bases back from the priming site. This may account for the equivocal performance of this primer on some templates.
Huyse, Zietara, Primer 2, reverse ITS-2-R:
5'-GGTAATCACGCTTGAATC-3'
Cable group reverse ITS-2 primer:
5'-GTCCGGATCCTCCGCTTATTGATATTGC-3'
Matejusova et al., 2001 reverse primer
5-TCCTCCGCTTAGTGATA-3'
The Huyse primer binds to the 28S gene some 20bp 5' of the Cable and Matejusova primers. Again, it is not a perfect match with the G. salaris sequence.
Conditions for amplification:
Huyse, Zietara use the following conditions:
4 minutes at 95°C then;
1 min 95°C
1 min 50°C
2 min 72°C
for 35 cycles
Cable et al. (1999) used a more complex protocol with higher annealing temperature:
2 mins at 94°C then:
15s at 94°C
30s at 60°C
45s at 72°C
increasing extension times by 15s every 4 cycles until after 30 cycles final conditions were:
15s at 94°C
30s at 60°C
2 mins at 72°C
Reaction terminated with a 6 min extension step at 72°C.
|
