Home - GyroDb Overview - News and Events - Biology - Biosystematics - Protocols - Submissions - Contacts

 

Tools



   List World Gyros

   Find Hosts for Gyro

   Find Gyros for Hosts



   View Hosts by Gyro

   View Gyros by Host

   View Sclerite Images


   View Hook Overlays


The Cytochrome Oxidase locus

The Cytochrome Oxidase 1 (COI) mitochondrial DNA locus

The circular mitochondrial genome is maternally inherited via the oocyte cytoplasm, and lacks recombination. It therefore diverges at a greater rate than nuclear loci, making it a good marker both for maternal patterns of inheritance, and for analysis of sub-species (population) evolution. The Cytochrome Oxidase 1 gene transcribes one subunit of the multimeric cytochrome oxidase enzyme complex. COI was sequenced relatively late in Gyrodactylus, and primers were first published by Meinila et al. (2002). This locus has since become very important in tracking local evolution in the G. salaris complex.

A word of warning: The scale of variation in COI (24% variation between G. salaris and G. lavareti) is such that not all of the variation will be selectively neutral. Mutations at the second base which affect amino acid sequence are already known, and it is likely that some of these mutants affect COI enzyme activity. This is a subject which has not been examined but which deserves more study. Furthermore, given what we know about reproductive biology in Gyrodactylus, heteroplasmy is possible, which could result in an individual aquiring more than one mitochondrial haplotype.

Meinila's (2002) primers for COI:

Forward:

5' TAATCGGCGGGTTCGGTAA 3'

5' GAACCATGTATCGTGTAGCA 3'

Reverse:

5' TAATTGGTGGGTTTGGTAA 3'

5' AGCTACCACGAACCATGTAT 3'

Amplification conditions:

3 mins 95C

then:

95C 1 min

50C 1 min

72C 1.5 mins

for 35 cycles.

then 7 mins at 72C to complete extension.

Hansen et al. (2002) used these primers or a two additional sets:

5'-GCGMCTAAATGCTTTAAGGGCTTG-3' with

5'-CCAAAGAACCAAAATAAGTGTTG-3'

or

5'-TGTCYCTACCAGTGCTAGCCGCTGG-3'with

5'-GAGGATAGCACTATCCCTGTCAC-3'

Amplification conditions were not given.

References

Hansen, H., Bachmann, L. & Bakke, T.A. (2002). Mitochondrial DNA variation of Gyrodactylus spp. (Monogenea, Gyrodactylidae) populations infecting Atlantic salmon, grayling,and rainbow trout in Norway and SwedenInternational Journal of Parasitology 33 1471-1478.

Meinila,M., Kuusela, J. Zietara, M. & Lumme, J. (2000).Primers for amplifying 820 bp of highly polymorphic mitochondrial COI gene of Gyrodactylus salaris Hereditas 137 72-74.


Home - GyroDb Overview - News and Events - Biology - Biosystematics - Protocols - Submissions - Contacts

This site is © Copyright GyroDb 2007, All Rights Reserved